Location: 100md.com > Paper > 1 > Text
.
A New Technique of Detecting ¦Â-thalassaemia Mutati

http://www.100md.com   
    RESEARCH ARTICELS

    A New Technique of Detecting ¦Â-thalassaemia Mutations from a Single Cell

    Ping Yi 1*, Li Li1, Hong Yao 1, Bing Deng 3, Zhuqin Chen 1, Yuanguo Zhou 2

    Abstract: To explore a technique for detecting ¦Â-thalassaemia multipoint mutations from a single cell simultaneously, a set of allele specific oligonucleotide (ASO) probes used for detecting the eight familiar ¦Â-thalassaemia mutations (CD41-42, IVS-II-654, CD17, TATA box nt-28, CD71-72, TATA box nt-29, CD26, IVS-I-5) were immobilized on a strip of nylon membrane. The genome of an individual cell was amplified by Primer Extension Preamplification (PEP) with the mixture of 15-base random oligonucleotides. The aliquots (5¦Ìl) from PEP were used to amplify the objective gene fractions of ¦Â-thalassaemia gene by nested or semi-nested PCR. The membrane was hybridized with the final amplified products and then treated with Streptavidin - HRP and color development. 3 lymphocytes were picked up from blood samples of 1 healthy female and 4 patients who had ¦Â-thalassaemia mutations respectively. Each single lymphocyte was lysed in the proteinase K buffer. The amplifIcation efficacy was 93.3% and the rate of dropping out allele was 6.7%. Reverse dot blot (RDB) was applied to the final amplified products from the five participants. The results of diagnosis were same to the expected ones, and their genotypes were N/N, CD17(A¡úT)/N, IVS-II-654(C¡úT)/CD17(A¡úT), CD41-42(-CTTT)/N and TATA box nt-28(A¡úG)/N, respectively. So we believe that, PEP and RDB could detect multiple ¦Â-thalassaemia mutations from a single cell simultaneously and be applied to preimplantation genetic diagnosis and non-invasive prenatal diagnosis for ¦Â-thalassaemia. The research provides experimental evidences for the feasibility of applying PEP and DNA array technology to screening multiple genetic mutations from a single cell.

    Key words: ¦Â-thalassaemia; preamplification; reverse dot blot (RDB)

    ¦Â-thalassaemia is one of the autosomal genetic blood diseases characterized by absent or decreased production of normal ¦Â-hemoglobin. It is caused by the mutations within the ¦Â-globin gene. Prenatal diagnosis for ¦Â-thalassaemia has been proven to be an effective strategy for controlling the incidence of new cases and is widely used in several countries where the disease is common. The amounts of DNA for preimplantation genetic diagnosis (PGD) and non-invasive prenatal diagnosis are very limited. The sensitivity of nested PCR is great enough to allow the analysis of DNA in a single cell. Successful PGD protocols for ¦Â-thalassaemia have been introduced by using nested PCR followed by restriction fragment length polymorphism (RFLP), single-stranded conformation polymorphism (SSCP) and direct sequencing [1-3]. However, a single cell can be analyzed only once and it is difficult to detect multiple mutations in any one cell by nested PCR. Most have not addressed the problem of diagnosing the wide spectrum of genotypes encountered in most populations in which ¦Â-thalassemia is common. With the above considerations, Kanavakis et al. had successfully used denaturing gradient gel electrophoresis (DGGE) for ¦Â-thalassemia PGD to test a large spectrum of mutations presented in the Greek population [4, 5]. Here, we developed another accurate, reliable protocol for the analysis of single-cell samples, applicable to PGD for the major genotypes of ¦Â-thalassemia in the Chinese population. The strategy involves PEP followed by nested PCR and reverse dot blot (RDB). The advantage of using PEP in PGD is that multipoint mutations from a single cell are analyzed simultaneously and repeated aliquots may be taken for independent nested-PCR reactions in the event of an ambiguous result.

    MATERIALS AND METHODS

    1. Production of common diagnostic membrane strip for ¦Â-thalassaemia mutations

    A set of amino-modified allele specific oligonucleotide (ASO) probes used for detecting the eight familiar ¦Â-thalassaemia mutations (CD41-42, IVS-II-654, CD17, TATA box nt-28, CD71-72, TATA box nt-29, CD26, IVS-I-5) were immobilized on a strip of nylon membrane according to Cai et al [6].

    2. Collection of single cell

    Each lymphocyte was diluted in phosphate-buffered saline, and 30¦Ìl of this solution were transferred to a petri dish and overlaid with light weight paraffin oil. Single lymphocytes were isolated from the diluted fluid under an inverted microscope equipped with micromanipulators (MF-90, Narishige, Japan). Individual lymphocytes were aspirated into a micropipette under the inverted microscope and transferred to an individual 3¦Ìl droplet of distilled water. After microscopic examination of each droplet, another micropipette was used to aspirate and transfer the lymphocyte to a lysis solution, consisting of 1¦Ìl 10?PCR buffer, 0.5¦Ìl 1%Triton?100, 7¦Ìl H2O and 0.1¦Ìl Proteinase K (20mg/ml) in a 200¦Ìl PCR tube. After spinning down at a low speed in a microfuge for a few seconds, the samples were covered with one drop of mineral oil and incubated at 45¡ãC for 15 min in a thermal cycle [7].

    3. Primer extension preamplification (PEP)

    The PEP procedure was performed according to Zhang et al [8], with some modification. To each tube, 40¦Ìl PCR mixture (final concentrations: 10mM Tris-HCl, pH 8.3, 50mM KCl, 2.5mM MgCl2, 100?M of each dNTPs, 33?M of 15-base random primers) was added. Finally, 4U EXTaqTM DNA polymerase (Takara, Japan) was immediately added before starting the PEP procedure. Fifty primer-extension cycles were carried out in a PTC100 thermocycler (MJ Research Inc. USA). Each cycle consisted of a 1 min denaturation step at 92¡ãC, a 2 min annealing step at 37¡ãC, a programed ramping step of 10s/degree to 55¡ãC and 4 min incubation at 55¡ãC for polymerase extension. A 5¦Ìl aliquot from each PEP product was taken as template for subsequent amplification of the ¦Â-globin mutation site.

    4. Nested PCR

    To amplify DNA from PEP products, a nested-PCR protocol was used to increase the sensitivity and specificity. Two sets of primer pairs were designed for two PCR assays (Table1). The first and second PCR mix contained PCR buffer (1.5mmol/L MgCl2, 10mmol/L Tris-HCl, pH 8.3, 50mmol/L KCl), 200¦Ìmol dNTP (Takara, Japan), 500pmol primers (HPLC purification grade, Takara, Japan) and 0.25U EXTaqTM DNA polymerase (Takara, Japan). PCR mix 1 contained the outer primers and PCR mix 2 contained the inner primers. In addition, PCR mix 2 contained 0.3¦Ìl biotine labeled dUTP. PCR mix 1 was added to each Eppendorf tube containing 5¦Ìl PEP products in order to obtain a 50¦Ìl total reaction volume. Each sample was put into a PTC100 thermocycler (MJ Research Inc. USA). The program of the PCR reaction 1 was 3 min at the initial 94¡ãC denaturation temperature, followed by 30 cycles of 30s at 94¡ãC, 90s at 62¡ãC, and a final extension step at 72¡ãC for 10 min. A 5¦Ìl aliquot of the first PCR products was added to 45¦Ìl PCR mix 2 and was run on the PCR program 2: 30 cycles of 30s of denaturation at 94¡ãC, 1 min of annealing at 55¡ãC, 1 min of extension at 72¡ãC and a final extension step at 72¡ãC for 10 min were carried out. 10¦Ìl aliquot of the second PCR product was analyzed on 20% agarose gel electrophoresis and visualized under UV-light after ethidium bromide staining.

    Table 1. Sequence of the primers used for the amplification of ¦Â-globin gene

    ¦Â-globin gene segment Primer Primer sequenceSize of products (bp)AB segmentOuter primer

    (AB1)

    nested primer

    (AB2)F5¨@GTACGGCTGTCATCACTTAGACCTCA3¨@

    R5¨@AACATCAAGGGTCCCATAGACTCAC 3¨@

    F5¨@GTACGGCTGTCATCACTTAGACCTCA3¨@

    R5¨@TGCAGCTTGTCACAGTGCAGCTCACT3¨@

    649

    602CD segmentOuter primer (CD1)

    nested primer

    (CD2)F5¨@GTGTACACATATTGACCAAA 3¨@

    R5¨@AGCACACAGACCAGCACGTT 3¨@

    F5¨@GGGCAATAATGATACAAT 3¨@

    R5¨@GAGCTGTGGGAGGAAGAT 3¨@423

    275

    5. Reverse dot blot

    Reverse dot blot was used to diagnose the mutation of the ¦Â-thalassaemia. The hybridization and washing of the membranes and the detection of the signals have been performed according to Xu et al [9].

    RESULTS

    1. Isolation of single lymphocyte

    Three single lymphocytes were obtained respectively from the blood samples of 1 healthy female and 4 patients with ¦Â-thalassaemia (marked by 1, 2, 3, 4, 5 in turn) under a microscope.

    2. Amplification of single lymphocyte

    After the single lymphocyte was amplified by PEP, each one obtained 5¦Ìl of the products. The AB2 fragment was amplified with semi-nested PCR and the CD2 fragment was amplified with nested PCR (Fig.1). Three lymphocytes were amplified in each sample and a total of 14 lymphocytes were amplified successfully, with the amplification efficiency of 93.3%. And the targeted fragment of 1 cell from Sample 1 was not amplified out (Table 2). The CD2 fragments in 1 cell each in Sample 3 and Sample 4 was not amplified successfully firstly, which was repeated and then succeeded.

    Table 2. Analysis of amplification from 5 blood samples

    SamplesDetected cell numberCell number amplified successfullyNumber of allele dropout13202330333143305330

    Fig. 1 Nested or semi-nested amplification of AB2 and CD2 from a single cell

    Lane.C1: negative control of PCR buffer solution used for washing a cell. Lane. C2: negative control of distilled water. Lane 1-5(left): amplified products of AB2 fragment. Lane 1-5(right): amplified products of CD2 fragment. Lane M: size maker of DL2000

    3. Results of common diagnostic membrane strip for ¦Â-thalassaemia mutations

    Reverse dot blot was successfully applied to detect the products of nested or semi-nested PCR of the above-mentioned 5 samples. The hybridized result was same to the expected. The genotypes were N/N, CD17(A¡úT)/N, IVS-II-654(C¡úT)/CD17(A¡úT), CD41-42(-CTTT)/N, and TATA box nt-28(A¡úG)/N, which suggested that the number of the targeted fragments after a single cell was amplified with PEP and nested PCR could meet the need of detecting gene mutation with RDB technique (Fig. 2). Mutation point CD17 (A¡úT) was not found after hybridization of a cell in Sample 3 (Fig. 3), which showed that allele dropout (ADO) occurred during PCR.

    Fig. 2 Detection of ¦Â-thalassaemia mutations by reverse dot blot

    For each strip, the normal ASO probes were fixed in the upper row, and the mutant allele probes were fixed in the lower row. The ¦Â-thalassaemia genotype of each sample was indicated at the right.

    Fig. 3 Detection of ¦Â-thalassaemia mutations by reverse dot blot from a cell of sample 3

    The genotype was IVS-II-654(C¡úT)/N

    DISCUSSION

    1. ¦Â-thalassaemia and selection of its gene mutation points

    Over 160 types of mutations have been found in the whole world, and 21 of them have been observed among Chinese. It is one of the most common single disorders in South China. According to the investigation by the National Hemoglobin Co-operation Group, the frequency of ¦Â-thalassaemia trait (carrier status) is 0.67% in our country and as high as 6% in some provinces of South China.

    The carriers of ¦Â-thalassaemia accounts for 0.67%, which is one of the genetic diseases with the highest incidence rate and the greatest influence in the provinces south to Yangtze River in China. Because of the many mutation types of ¦Â-thalassaemia, many couples carry different mutation types, which resulted in the complexity and difficulty of PGD. According to the statistical results of 1, 225 chromatosomes isolated from persons in provinces or areas of Guangxi, Fujian, Taiwan, Hongkong, Sichuan, Guizhou, Hubei, East China and Guangdong, the most common mutations are (in proper order) CD41-42(41.6%), IVS-II-654 (21.8%), CD17(18.0%), TATA box nt-28 (8.0%), CD71-72(3.9%), TATA box nt-29(1.2%)£¬and the other(5.5%). Among the other 15 mutations, the gene frequencies of CD26 and IVS-I-5 are higher and the other 13 are seldom observed [10]. So, the above-mentioned 8 different alleles comprise over 95% of the mutations found in China. In this study, we explored the feasibility of detecting the multiple mutations of ¦Â-thalassaemia in single lymphocyte when the common 8 mutation points (CD41-42, IVS-II-654, CD17, TATA box nt-28, CD71-72, TATA box nt-29, CD26, and IVS-I-5) were taken as the gene sites.

    2. PEP and diagnosis of ¦Â-thalassaemia

    The genome of single cell is amplified by PEP with the mixture of 15-base random primers, which can amplify the whole DNA sequences theoretically. After PEP, it is estimated that at least 78% of the genomic sequences in a single human haploid cell can be copied no less than 30 times. As a result, only a small aliquot of the amplified sample has to be used to analyze any one gene and material remains for additional analysis [8].

    The sensitivity of nested PCR technique has approached to a single cell level. Combined with RFLP, SSCP and direct sequencing, nested PCR has successfully applied to the PGD of ¦Â-thalassaemia. But nested PCR can difficultly diagnose the multiple genes of a single cell or the multiple dispersed sites of a gene, and it cannot be verified repeatedly. Though multi-nested PCR exists at present, it is unrealistic to specifically amplify several or several tens of primers on the level of single cells. If the single cell were amplified by PEP before nested PCR, the amplified templates of single cells' PCR would be increased undoubtedly. Simultaneously, the other PEP products can be used for repeated experiments when the results are not ideal or the previous experiment fails, which can increase the accuracy of diagnosis and the possibility to diagnose the multiple genetic sites. Therefore, we apply technique PEP to improve the accuracy of PCR and provide more gene fragments for RDB technique.

    In this study, single lymphocytes were preamplified by PEP. Then semi-nested amplification was made on the AB2 fragment and nested amplification on the CD2 fragment, with the amplification efficiency of 93.3%. Among them, 2 cells were not amplified to produce CD2 fragment with nested PCR, which succeeded with repeated amplification.

    3. RDB technique, DNA array and genetic diagnosis on single cells

    PCR/RDB has been applied to detect the site of gene mutation of ¦Â-thalassaemia in the whole blood, which simplifies the diagnostic process greatly [6]. In this study, 8 pairs of ASO probes were used to detect 8 familiar ¦Â-thalassaemia mutations, respectively. The ASO probes were immobilized on a strip of nylon membrane, which was made into the common membrane strip. Then the final products of PCR were hybridized with the membrane strips for diagnosing mutations of ¦Â-thalassaemia. The result is the same as the expected one. It suggests that the number of the targeted fragments after a single cell amplified with PEP and nested PCR can meet the need of detecting the gene mutations with RDB technique, and it is practicable to detect the gene mutations of ¦Â-thalassaemia in single lymphocytes with the united application of PEP and RDB. Simultaneously, the pre-detected genetic sites increased significantly, which made the procedure easier and could be used in the genetic diagnosis PGD and in non-invasive prenatal diagnosis.

    The familiar membrane strip for diagnosing mutations of ¦Â-thalassaemia is actually a DNA array taking a nylon membrane as the carrier. The basic principle of DNA sequence is RDB. DNA array can immobilize oligonucleotide probes corresponding to gene mutations of teens or decades genetic diseases. When it is used for detecting these mutations, first of all the targeted fragments corresponding mutations must be amplified and labeled. For example, when PEP is applied before nested PCR, 50¦Ìl PEP products are equally divided into 10 parts or 20 parts. Then each part is designed for one or several pairs of primers, which may provide more gene fragments for hybridization for DNA array and so, make the diagnostic gene sites increase greatly. That is to say, this method can detect more gene mutations from one disease or various diseases at the same time. Therefore, this study provides experimental evidences for the feasibility of applying PEP and DNA array technology to screening multiple genetic mutations from a single cell. Besides, this method may have good practical value for PGD and non-invasive prenatal diagnosis.

    REFERENCES

    1. Palmer GA, Traeger-Synodinos J, Davies S, et al. Pregnancies following blastocyst stage transfer in PGD cycles at risk for beta-thalassaemia haemoglobinopathies. Hum Reprod. 2002, 17(1): 25-31.

    2. Kuliev A, Rechitsky S, Verlinsky O, et al. Birth of healthy children after preimplantation diagnosis of thalassemias. J Assist Reprod Genet.1999, 16(4): 207-211.

    3. Hussey ND, Davis T, Hall JR, et al. Preimplantation genetic diagnosis for beta-thalassaemia using sequencing of single cell PCR products to detect mutations and polymorphic loci. Mol Hum Reprod. 2002, 8(12): 1136-1143.

    4. Kanavakis E, Vrettou C, Palmer G, et al. Preimplantation genetic diagnosis in 10 couples at risk for transmitting beta-thalassaemia major: clinical experience including the initiation of six singleton pregnancies. Prenat Diagn. 1999, 19(13): 1217-1222.

    5. Vrettou C, Palmer G, Kanavakis E, et al. A widely applicable strategy for single cell genotyping of beta-thalassemia mutations using DGGE analysis: application to preimplantation genetic diagnosis. Prenat Diagn. 1999, 19(13): 1209-1216.

    6. Cai SP, Wall J, Kan YW, et al. Reverse dot blot probes screening of ¦Â-thalassaemia in mutation in Asians and American blacks. Hum Mutat. 1994, 3: 59.

    7. Rechitsky S, Verlinsky O, Amet T, et al. Reliability of preimplantation diagnosis for single gene disorders. Molecular and Cellular Endocrinology. 2001, 183: 65-68.

    8. Zhang L, Cui X, Schmitt K, et al. Whole genome amplification from a single cell: implications for genetic analysis. Proc Natl Acad Sci USA.1992, 89: 5847-5851.

    9. Xu X, Liao C, Liu Z, et al. Antenatal screening and fetal diagnosis of beta-thalassemia in a Chinese population: prevalence of the beta-thalassemia trait in the Guangzhou area of China. Hum Genet. 1996, 98: 199-202.

    10. Zhou Y, Xu X. Molecular basis and prenatal diagnosis of beta-thalassemia among Chinese. Foreign Medical Science Genetics Section.1995, 18(3): 132-137.

    (Edited by Yanling Xiao, Yang Zhao and Yingqi Zhao)

    * Corresponding to Ping Yi, PhD, Main research field: prenatal diagnosis; Tel: 13368048599; E-mail: pingyi@163.com

    Li Li, female, professor, Main research field: reproductive medicine; Address: Daping Hospital and Medical Institute of Surgery of the Third Military Medical University, Chongqing, Postcode: 400042; Tel: 023-68757249,023-68757196;

    1 Department of Obstetrics and Gynecology, Daping Hospital ,the Third Military Medical University, Chongqing, 400042.

    2 Department of Molecular Biology, Daping Hospital and Medical Institute of Surgery of the Third Military Medical University, Chongqing, Postcode: 400042.

    3 Children's Hospital, the Medical University of Chongqing, Chongqing, Postcode: 400014.

 
.