Location: 100md.com > Paper > 6 > Text
.
Paternal Leakage of Mitochondrial DNA in the Great Tit (Parus major)

http://www.100md.com    中华首席医学网
     * Department of Biology, University of Oulu, Oulu, Finland

    Institute of Zoology, Johannes Gutenberg University, Mainz, Germany

    Institute of Biology and Soil Science, Far East Branch; Vladivostok, Russia

    Abstract

    Animal mitochondrial DNA is normally inherited clonally from a mother to all her offspring. Mitochondrial heteroplasmy, the occurrence of more than one mitochondrial haplotype within an individual, can be generated by relatively common somatic mutations within an individual, by heteroplasmy of the oocytes, or by paternal leakage of mitochondria during fertilization of an egg. This biparental inheritance has so far been reported only in mice, mussels, Drosophila, and humans. Here we present evidence that paternal leakage occurs in a bird, the great tit Parus major. The major and minor subspecies groups of the great tit mix in the middle Amur Valley in far-eastern Siberia, where we found a bird that possessed the very distinct haplotypes of the two groups. To our knowledge this is the first report of paternal leakage in birds.

    Key Words: heteroplasmy • hybrid zone • mitochondrial control region • Parus major

    Introduction

    Mitochondrial heteroplasmy has been reported in a wide range of species, including insects (Drosophila:), birds (gulls: ), fish (perch: ), and mammals (mice: bats: dogs: ; and humans: ). The benign heteroplasmic conditions mostly involve length variation caused by the variable number of tandem repeats in the noncoding control region of the mitochondrial genome . This length variation is thought to have arisen through slipped strand mispairing during replication . Pathogenic mitochondrial diseases, well documented in humans, are often caused by large deletions, and their clinical features reflect the frequency and tissue distribution of the mutant mitochondria . Heteroplasmic single nucleotide polymorphisms have also been reported in several species (cattle human razorbill: ). All of these forms of heteroplasmy can be generated by somatic mutations within an individual or by heteroplasmy of the oocytes.

    Another possibility is that heteroplasmy may arise through paternal leakage, which is to say that the paternal mitochondria are not always eliminated during fertilization of an egg. Paternal leakage has been reported to occur from time to time in Drosophila, mice, mussels, and humans ( respectively). One explanation proposed to account for the rare detection of biparental inheritance of mitochondria is that the two haplotypes should be dissimilar enough to be detected during usual screening, e.g., for population genetic studies. Studies of hybrid zones, where populations harboring relatively genetically distant mitochondrial haplotypes meet, provide an ideal opportunity to search for paternal mitochondrial leakage. Here we present evidence that introgression and paternal leakage of mitochondrial haplotypes occurs in a hybrid zone where two subspecies groups of the great tit, Parus major, meet. To our knowledge this is the first report of paternal leakage in birds.

    Materials and Methods

    The great tit has been classified into four subspecies groups; major (occurring in Europe, Siberia, and northwest Africa), minor (occurring in China, Japan, and eastern Russia), cinereus (occurring from Iran east to India and southeast Asia), and bokharensis (occurring in central Asia), consisting of altogether about 30 subspecies ( pp. 145–281; pp. 353–367). Some hybridization between these subspecies groups is known to occur in the regions where they meet. The major and minor groups mix in the middle Amur Valley in far-eastern Siberia, where major occupies open agricultural and other human-associated habitats, but minor is observed mainly in semi-open hilly woodlands .

    We extracted DNA from blood samples using the standard phenol-chloroform procedure from a total of 27 great tits originating from four sampling sites in the middle Amur Valley. Of these birds, 15 were phenotypically major and 12 were minor birds or individuals close to those phenotypes. Amplification of the mitochondrial control region was performed with primers L16700 (5'ATCATAAATTCTCGCCGGGACTCT3') and H636 (5'GAGATGAGGAGTATTCAACCGAC3'). The amplified region covered all of the first domain and part of the second domain of the control region. Polymerase chain reaction (PCR) was performed in 50 µl volume containing about 250 ng of template DNA, 1.0 µM of each primer, 0.2 mM of each dNTP, 5 µl of 10x PCR buffer (2.5 mM MgCl2), and 1.0 unit of Dynazyme (Finnzymes). The amplification profile was 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, 53°C for 1 min, and 72°C for 1 min, and a final extension in 72°C for 5 min. Sequencing reactions were performed with the primer H636 with Big Dye Terminator Cycle Sequencing Kit version 2.0 and run with the ABI 377 automatic sequencer.

    The sequence from one phenotypically major individual was repeatedly a mixture of minor and major haplotypes, making the sequence unreadable after a region where there were two indels (the one of a single and the other of two base pairs) between the different haplotypes. Therefore, new primer pairs were designed to amplify only the minor (L16700 + H328minor 5'GGGACATTA-TTCGTATACTGG3' and L288minor 5'CGTACAT-ACAAACTCCACCAG3' + H636) or major (L16700 + H351major 5'CTTTAGGAGGTGGGCTTCATGC3' and L288major 5'ACAAACTCCACTCTAGTATACGGA3' + H636) haplotypes. The PCR conditions were the same as described above.

    Sequencing reactions were performed with primers H328minor (5' end of the minor control region), H351major (5' end of the major control region), or H636 (central part of major or minor control region). These primers produced pure major (GenBank accession number and minor (GenBank accession number sequences from this individual, from which both haplotypes were sequenced (altogether 578 bp) four times from independent PCRs. A maximum likelihood tree of the 28 sequences (GenBank accession numbers –) was constructed using the program fastDNAml , with a transition/transversion ratio of 11, empirical base frequencies, and 100 bootstraps.

    In addition, to rule out a possible mixing of two samples in one, six polymorphic microsatellite loci from the heteroplasmic bird were screened: Pdo5 , Pocc6 , Esc6 , PK12 (GenBank accession number ), Ppi2 , and Pca8 . One specimen of a minor genotype and one of a major genotype were screened for comparison. Pdo5, Esc6, and Ppi2 were amplified in a 10 µl PCR containing 50 ng of template DNA, 0.4 µM of each primer, 0.1 mM of each dNTP, 1 µl of 10x PCR buffer (2.5 mM MgCl2), and 0.16 units of Dynazyme (Finnzymes) using the following profile: 94 for 2 min followed by 35 cycles of 94°C for 45 s, 50°C for 45 s, and 72°C for 45 s; and a final extension in 72°C for 2 min. Pocc6, Pca8, and PK12 were amplified similarly, except the annealing temperature was 55°C, and MgCl2 was 3.0 mM for Pca8 and 1.5 mM for PK12.

    Results and Discussion

    Of the 27 birds sampled from the middle Amur Valley one bird of major phenotype had both minor and major mitochondrial haplotypes. All other samples proved to be phenotypically and genotypically from the same subspecies group. The difference between the two haplotypes within the heteroplasmic birds was 6.24% (31 transitions, 3 transversions, one 1-bp indel, and one 2-bp indel). From these substitutions 27 transitions, 2 transversions, and the indels are fixed differences between the minor and major haplotypes according to our larger body of unpublished data. The PCR products performed with minor or major specific primers were approximately of even quantity when judged from agarose gels. The possibility of amplifying a nuclear copy was ruled out, for two reasons: (1) all other amplifications did not reveal any traces of another haplotype and (2) in the phylogenetic tree, the haplotypes of the heteroplasmic bird were placed within the monophyletic clades of the respective haplotypes .

    fig.ommitted

    FIG. 1. A maximum likelihood tree from the great tits from the hybrid zone in the middle Amur Valley. The number on each branch represents the bootstrap support of that branch. The haplotype names correspond to the names of the sampling sites, and the subscripts correspond to the sequence identification in the GenBank (accession numbers –) and the Martens (MAR) tissue collection. The haplotypes of the heteroplasmic bird are shaded

    Five of the screened microsatellite loci were heterozygotes and one (Pocc6) was a homozygote. This finding is proof against an accidental mixing of samples of two individuals into one, which would have been revealed by at least some of these highly polymorphic loci (from 7 to 20 alleles according to the Bird microsatellite primer cross-utility database of the Sheffield Molecular Genetics Facility) having contained more than two alleles.

    Obviously, introgression of mitochondrial haplotypes must occur from one group to another as a result of hybridization. Finding a heteroplasmic bird having the two very distinct haplotypes of minor and major was, however, a surprise, because this kind of heteroplasmy very likely occurred by paternal leakage, not somatic mutations. Heteroplasmic conditions thus far reported from other bird species may have been generated by two distinct somatic mutational processes. Variable numbers of heteroplasmic tandem repeats, likely produced through slipped strand mispairing , have been documented at least in the shrike (Lanius ludovicianus: ), in some auks, gulls, and a wader (family Laridae and Calidris maritima: ), and in other gulls and some terns (genera Larus and Sterna: ). To our knowledge, the only bird species which has been shown to be heteroplasmic due to a single-site base substitution is the razorbill (Alca torda: ). In the case reported here, the difference between the two haplotypes of the heteroplasmic great tit is too large to be explained by somatic mutations within an individual, and it would be highly unlikely that such somatic mutations would result in a haplotype of a sympatric subspecies group.

    Whether the mitochondrial DNA has leaked from the father of the bird, or whether such leakage occurred in previous generations and was followed by maternal transmission of the heteroplasmy, cannot be determined, even though the fact that the phenotype is of a major type supports an older introgression from minor to major. Some authors have reported that the proportion of different mitochondrial haplotypes estimated from all the offspring is about the same as the proportion in their heteroplasmic mother, but the level of heteroplasmy varies among the offspring ( and references therein). Often, heteroplasmic conditions are resolved within one or few generations through a bottleneck during oogenesis, a process analogous to strong genetic drift (e.g ). The level of heteroplasmy also varies in different tissues, as seen, for example, in humans, where clinical features in the affected tissues differ, depending on the relative amounts of pathogenic mitochondria and normal mitochondria Unfortunately, there are no data from which to examine the transmission of mitochondria from parents to offspring in birds or to study the possible proportional differences of mitochondrial haplotypes in different tissues. In mice, there is some experimental evidence for persistent transmission of the leaked haplotype to subsequent generations and other evidence against ongoing transmission (Shitara et al. 1998). The proportion of leaked mitochondria in mice has been estimated from intraspecific crosses to be about 0.01% . From crossing experiments of Drosophila simulans x D. mauritiana, the proportion of leaked paternal mtDNA per fertilization was estimated to be about 0.1%. In three of 331 lines, the maternal type was completely replaced by the paternal type of mitochondria, whereas a fourth line was heteroplasmic .

    Paternal leakage of mitochondria seems to be a widespread phenomenon among the animal phyla, being present at least in molluscs, insects, and vertebrates (mammals and birds). Further studies of hybrid zones could give more insight into the extent of paternal leakage in the animal kingdom, but estimation of the amount and persistence of leaked mitochondria would need controlled laboratory experiments. Paternal leakage of relatively distinct mtDNA also composes a framework for detection of possible mitochondrial recombination, a phenomenon which has recently been the subject of strong debate ( and references therein).

    Acknowledgements

    We are grateful to Pekka Pamilo, Jaakko Lumme, and Minna Ruokonen for valuable comments on this paper. This work was funded by the Research Council for Biosciences and Environment of the Academy of Finland (grants 45178, 51858, 47195, 35742, and 51275); the Deutsche Ornithologen-Gesellschaft, the Forschungskommission; Gesellschaft für Tropenornithologie; and the Feldbausch Foundation, Fachbereich Biologie, Universität Mainz.

    Literature Cited

    Ashley, M. V., P. J. Laipis, W. W. Hauswirth. 1989. Rapid segregation of heteroplasmic bovine mitochondria. Nucleic Acids Res. 17:7325-7331.

    Bensch, S., T. Price, J. Kohn. 1997. Isolation and characterization of microsatellite loci in a Phylloscopus warbler. Mol. Ecol. 6:91-92.

    Berg, T., T. Moum, S. Johansen. 1995. Variable numbers of tandem repeats make birds of the order Ciconiiformes heteroplasmic in their mitochondrial genomes. Curr. Genet. 27:257-262.

    Chinnery, P. F. 2002. Modulating heteroplasmy. Trends Genet. 18:173-176.

    Chinnery, P. F., D. R. Thorburn, D. C. Samuels, S. L. White, H.-H. M. Dahl, D. M. Turnbull, R. N. Lightowlers, N. Howell. 2000. The inheritance of mitochondrial DNA heteroplasmy: random drift, selection or both? Trends Genet. 16:500-505.

    Cramp, S., C. M. Perrins. 1993. The birds of the Western Palearctic, Vol. 7. Flycatchers to shrikes. Oxford University Press, London.

    Crochet, P.-A., E. Desmarais. 2000. Slow rate of evolution in the mitochondrial control region of gulls (Aves: Laridae). Mol. Biol. Evol. 17:1797-1806.

    Dawson, D. A., O. Hanotte, C. Greig, I. A. K. Stewart, T. Burke. 2000. Polymorphic microsatellites in the blue tit Parus caeruleus and their cross-species utility in 20 songbird families. Mol. Ecol. 9:1941-1944.

    Densmore, L. D., J. W. Wright, W. M. Brown. 1985. Length variation and heteroplasmy are frequent in mitochondrial DNA from parthenogenetic and bisexual lizards (genus Cnemidophorus). Genetics 110:689-707.

    DiMauro, S., E. A. Schon. 2001. Mitochondrial DNA mutations in human disease. Am. J. Med. Genet. 106:18-26.

    Eyre-Walker, A., P. Awadalla. 2001. Does human mtDNA recombine? J. Mol. Evol. 53:430-435.

    Gocke, C. D., F. A. Benko, P. K. Rogan. 1998. Transmission of mitochondrial DNA heteroplasmy in normal pedigrees. Hum. Genet. 102:182-186.

    Griffith, S. C., I. R. K. Stewart, D. A. Dawson, I. P. F. Owens, T. Burk. 1999. Extra-pair paternity in mainland and island populations of a socially monogamous bird, the house sparrow (Passer domesticus): is there an "island effect"? Biol. J. Linnean Soc. 68:303-316.

    Gyllensten, U., D. Wharton, A. Josefson, A. Wilson. 1991. Paternal inheritance of mitochondrial DNA in mice. Nature 352:255-257.

    Hanotte, O., C. Zanon, A. Pugh, C. Greig, A. Dixon, T. Burke. 1994. Isolation and characterization of microsatellite loci in a passerine bird: the reed bunting Emberiza schoeniclus. Mol. Ecol. 3:529-530.

    Harrap, S., D. Quinn. 1996. Tits, nuthatches & treecreepers. Christopher Helm Ltd, London.

    Hauswirth, W. W., P. J. Laipis. 1982. Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc. Natl. Acad. Sci. USA 79:4686-4690.

    Kondo, R., Y. Satta, E. T. Matsuura, H. Ishiwa, N. Takahata, S. I. Chigusa. 1990. Incomplete maternal transmission of mitochondrial DNA in Drosophila. Genetics 126:657-663.

    Lunt, D. H., L. E. Whipple, B. C. Hyman. 1998. Mitochondrial DNA variable number tandem repeats (VNTRs): utility and problems in molecular ecology. Mol Ecol. 7:1441-1455.

    Martens, J. 1996. Vocalizations and speciation of Palearctic birds. Pp. 221–240 in D. E. Kroodsma and E. H. Miller, eds. Ecology and evolution of acoustic communication in birds. Cornell University Press, Ithaca, N.Y.

    Martinez, J. G., J. J. Soler, M. Soler, A. P. Møller, T. Burke. 1999. Comparative population structure and gene flow of a brood parasite, the great spotted cuckoo (Clamator glandarius), and its primary host, the magpie (Pica pica). Evolution 53:269-278.

    Moum, T., I. Bakke. 2001. Mitochondrial control region structure and single site heteroplasmy in the razorbill (Alca torda; Aves). Curr. Genet. 39:198-203.

    Mundy, N. I., C. S. Winchell, D. S. Woodruff. 1996. Tandem repeats and heteroplasmy in the mitochondrial control region of the loggerhead shrike (Lanius ludovicianus). J. Hered. 87:21-26.

    Nesbø, C. L., M. O. Arab, K. S. Jakobsen. 1998. Heteroplasmy, length and sequence variation in the control regions of three percid fish species (Perca fluviatilis, Acerina cernua, Stizostedion lucioperca). Genetics 148:1907-1919.

    Olsen, G. I., H. Matsuda, R. Hagstöm, R. Overbeek. 1994. FastDNAml: a tool for construction of phylogenetic trees of DNA sequences using maximum likelihood. Comput. Applic. Biosci. 10:41-48.

    Savolainen, P., L. Arvestad, J. Lundeberg. 2000. mtDNA tandem repeats in dogs and wolves: mutation mechanism studied by analysis of the sequence imperfect repeats. Mol. Biol. Evol. 17:474-488.

    Schwartz, M., J. Vissing. 2002. Paternal inheritance of mitochondrial DNA. N. Engl. J. Med. 347:576-580.

    Shitara, H., J.-I. Hayashi, S. Takahama, H. Kaneda, H. Yonekawa. 1998. Maternal inheritance of mouse mtDNA in interspecific hybrids: segregation of the leaked paternal mtDNA followed by the prevention of subsequent paternal leakage. Genetics 148:851-857.

    Solignac, M., M. Monnerot, J.-C. Mounolou. 1983. Mitochondrial DNA heteroplasmy in Drosophila mauritiania. Proc. Natl. Acad. Sci. USA 80:6942-6946.

    Wilkinson, G. S., A. M. Chapman. 1991. Length and sequence variation in evening bat D-loop mtDNA. Genetics 128:607-617.

    Zouros, E., K. R. Freeman, A. O. Ball, G. H. Pogson. 1992. Direct evidence for extensive paternal mitochondrial DNA inheritance in the marine mussel Mytilus. Nature 359:412-414.

    Accepted for publication October 9, 2002.
(Laura Kvist Jochen Martens Alexander A. Nazarenko and Markku Orell)
 
.