Abstract
Objective— Protease-nexin 1 (PN-1) belongs to the serpin superfamily and behaves as a specific thrombin inhibitor in the pericellular environment. Little is known about PN-1 expression and its regulation in the vascular system. In this study, we examined the expression of functionally active PN-1 in vitro in rat aortic smooth muscle cells and in vivo in rat arterial media and its regulation in hypertensive rats.
Methods and Results— The vascular PN-1 formed specific covalent complexes with thrombin involving the catalytic site of the protease, and heparin increased the formation of these complexes. We also demonstrated PN-1 in rat arterial media by immunohistochemical staining. Moreover, we examined in vivo vascular expression of PN-1 in a model of chronic hypertension induced by long-term administration of NG-nitro-L-arginine methyl ester (L-NAME). Marked increases in PN-1 mRNA (3-fold) and protein (2-fold) were observed after 2 months of hypertension. Increased expression of PN-1 in the vascular wall was associated with an increase in the formation of complexes between radiolabeled-thrombin and PN-1, indicating that PN-1 was functional.
Conclusions— PN-1 may thus participate in the mechanisms that regulate thrombin activity in the vessel wall.
Key Words: protease-nexin 1 smooth muscle cells aorta hypertension thrombin
Introduction
Protease nexin 1 (PN-1) is a 43- to 45-kDa protease inhibitor that belongs to the serpin superfamily. PN-1 is secreted by a wide range of cultured cells, including glial cells and neurons,1 human foreskin fibroblasts,2 and human skeletal muscle myotubes,3 and is present in platelets but is barely detectable in plasma. In cell cultures, PN-1 rapidly inhibits its target proteases (trypsin, {alpha}
-thrombin, plasminogen activators, and plasmin4), forming SDS-stable equimolecular complexes that are rapidly internalized and degraded.5 Secreted PN-1 binds tightly to the extracellular matrix (ECM). Binding occurs mostly via the heparan-sulfates and regulates both PN-1 activity and specificity. PN-1 interaction with heparan sulfates accelerates thrombin inhibition, the protease becoming thus the preferred target protease.6 In addition, it has been reported that PN-1 also interacts with collagen IV, which decreases the rate of inhibition of urokinase and plasmin without affecting the rate of thrombin inhibition by PN-1.7 PN-1 is therefore considered to be a specific thrombin inhibitor in the pericellular environment.8
Thrombin exerts several direct effects on vascular cells. The specific roles of thrombin in modulating the responses to vascular injury are relatively complex. Indeed, thrombin has been shown to elicit an inflammatory response, to induce smooth muscle cells (SMCs) to synthesize collagen that may contribute to ECM accumulation, and to stimulate SMC contraction and proliferation. Moreover, a growing body of evidence from a broad range of animal models indicates the importance of thrombin-promoted neointima formation in arterial lesions. Thus, thrombin probably plays a significant role in the vasculoproliferative response to injury.9 A critical question raised by these observations concerns the regulation of thrombin within the vessel wall. Although both thrombin and the plasma thrombin inhibitor antithrombin have been detected in human aortic intima, thrombin-antithrombin complexes have not been observed in atherosclerotic plaques,10 indicating that thrombin activity is not regulated by antithrombin within the atherosclerotic arteries. Colocalization of PAI-1, vitronectin, and thrombin in the neointima of human atherosclerotic arteries has been observed, but the existence of a mechanism of thrombin regulation by PAI-1/vitronectin complexes in the vessel wall remains to be demonstrated.11 PN-1 is clearly another potential candidate for thrombin inhibition in the vascular wall, but no direct evidence for its presence in the vessels has yet been provided. The aim of this study was to investigate whether PN-1 is produced by vascular smooth muscle cells. Our results show that PN-1 is expressed both in vitro in rat vascular smooth muscle cells in culture and in vivo in rat arterial media. In addition, our data indicate that the vascular expression of PN-1 is upregulated in an in vivo rat model of chronic hypertension induced by long-term administration of the orally active nitric oxide synthase (NOS) inhibitor, NG-nitro-L-arginine methyl ester (L-NAME).
Methods
Purified Proteins
Human {alpha}
-thrombin (EC.3.4.21.5) was purified and iodinated as previously described.12 Recombinant rat PN-1, a generous gift from Pr D. Monard, (FMI, Basel, Switzerland) was produced in yeast as previously reported.13
Cell Culture
Rat aortic smooth muscle cells (RASMCs) were isolated from 180 to 200 g male Wistar rats and cultured in DMEM (Life Technologies) with 10% FCS, as previously described,14 and cells were used for experimentation after 3 to 5 passages. RASMCs were identified by their characteristic hill and valley growth appearance and by immunostaining for SMC {alpha}
-actin. When RASMCs reached confluence, the culture medium was replaced with serum-free medium for 1 day before treatment with the different agonists.
Animals
Male Wistar rats (120 to 130 g, IFFA CREDO, Lyon, France) were divided into the following 3 groups: (1) a control group (n=14); (2) a group treated with L-NAME (n=19, 50 mg/kg per day in the drinking water, Sigma Chemical Co); and (3) a group treated with L-NAME supplemented with the angiotensin-converting enzyme (ACE) inhibitor zofenopril (n=14, 15 mg/kg per day in food intake, Firenze). The procedures used for the care and euthanasia of the animals were in accordance with the European Community Standards (Ministère de l’Agriculture, France; authorization No. 00577).
Systolic blood pressure and heart rate were measured once a week by the tail-cuff method, and body weights were recorded. After 8 weeks of treatment, the rats were killed. The aortas were rapidly excised and rinsed in cold Hanks’ balanced salt solution. The media was isolated from the aorta by removing the endothelium and adventitia.14
Reverse Transcription and Semiquantitative Polymerase Chain Reaction
Total cellular RNA was isolated from RASMCs and aortic samples with the Trizol reagent (Invitrogen), according to the manufacturer’s directions. Double-stranded cDNAs were synthesized and amplified as previously described.15 The amplification was carried out for PN-1 with an initial 5 minutes of denaturation at 95°C, 29 cycles of 1 minute at 95°C, 1 minute at 50°C and 1 minute at 72°C, and then 7 minutes at 72°C. For the housekeeping gene GAPDH, the polymerase chain reaction (PCR) was performed for 27 cycles, and the annealing temperature was 56°C. The sense primer for PN-1 was 5'GACCACAGTGACTTTATACT3' and the antisense primer was 5'GGCTGGGTCCTGGAA GTT3'; the sense primer for GAPDH was 5'GTGAAGGTCGGAGTCAACG3' and the antisense primer was 5'GGTGAAGACGCC AGTGGACTC3'. PN-1 mRNA levels were normalized to GAPDH mRNA.
Western Blot Analysis
Proteins were extracted from aortic samples or RASMCs in ice-cold lysis buffer (50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, 3 mmol/L EDTA, 0.25% Tx-100) and centrifuged at 12 000g at 4°C for 30 minutes. Protein concentrations were measured using a Bio-Rad protein assay. For immunoblotting of PN-1, the monoclonal 4B3 anti–PN-1 antibody (750 µg/mL, dilution 1:700, a kind gift from Pr D. Monard) was used, followed by peroxidase-conjugated anti-mouse IgG (dilution 1:8000) (Amersham) and the chemiluminescence system ECL (Amersham).
Detection of 125I-{alpha}
-Thrombin-PN-1 Complexes in Aortic Extracts
Complexes between PN-1 present in aortic extracts and 125I-{alpha}
-thrombin were formed by incubating 20 nmol/L 125I-{alpha}
-thrombin with 100 µg protein extracts derived from aortas at 37°C for 15 minutes in 20 mmol/L NaH2PO4, pH 7.4, 100 mmol/L NaCl, 0.1 mmol/L EDTA, 0.1% polyethylene-glycol 6000. Some experiments were conducted with different {alpha}
-thrombin ligands: 10 IU/mL hirudin (Serbio), its sulfated C-terminal peptide 54 to 65 (27 µmol/L SH 54 to 65) (Bachem), or 150 IU/mL heparin (Choay). Other experiments were performed in the presence of the unlabelled {alpha}
-thrombin in up to 100-fold excess or in the presence of 20 nmol/L Pro-Phe-Arg-chloroethyl-ketone (PPACK) (Calbiochem). Samples were boiled for 5 minutes in the presence of 2% SDS. Radiolabeled bands were detected after separation of the proteins by 10% SDS-PAGE and autoradiographed.
Immunohistochemical Detection of PN-1
Immunohistochemical detection of PN-1 in frozen-fixed sections (5 µm) from rat aorta and in RASMCs was performed with the use of the PN-1 monoclonal antibody 4B3 (750 µg/mL, dilution 1:50), as previously described.16 For control staining, the first antibody was either omitted or replaced by an isotype-matched antibody directed against ACE.
Intracellular Calcium Mobilization
RASMCs were loaded for 1 hour at room temperature with 5 µmol/L Fluo3-AM and 0.02% Pluronic acid in DMEM and then washed with Tyrode solution. Confocal images were acquired using a Zeiss LSM-510 inverted confocal microscope with a LD Achroplan x40 objective (Zeiss) (numeric aperture, 0.6). Fluo3-AM was excited by the 488-nm line of an argon laser, and fluorescence was measured at >505 nm. Zeiss confocal software Windows NT controlled the scanner module and performed images analysis.
Proliferation Assay
RASMCs were plated in a 96-well plate and grown to 80% confluence. Proliferation was measured using a colorimetric assay based on the measurement of BrDu incorporation during DNA synthesis (Roche), according to the manufacturer’s procedure.
Statistical Analysis
Data are expressed as mean±SEM. Statistical significance was estimated between groups by 1-way ANOVA followed by Bonferroni analysis. Differences were considered significant at P<0.05.
Results
PN-1 Expression In Vitro in RASMCs
As shown in PN-1 mRNA was detected by reverse transcriptase (RT)-PCR in cultured RASMCs at confluence, and Western blot analysis demonstrated the presence of the protein in the cell extracts. In these experiments , recombinant rat PN-1 appeared as a double band with a major band migrating at 41 kDa; the double-band character of the protein has been previously explained by a differential glycosylation pattern by yeast cells.13 In the RASMC extracts, PN-1 was detected as a single band of 45 kDa. A nonidentified additional band migrating at {approx}
110 kDa was observed.
fig.ommitted
PN-1 is present in RASMCs and in rat aorta. RT-PCR and Western blotting detect PN-1 from confluent RASMC cultures and from aortic extracts.
The distribution of PN-1 antigen in RASMCs was analyzed by immunostaining with the monoclonal antibody anti-PN-1. PN-1 immunoreactivity in nonpermeabilized RASMCs was intense and uniform, indicating the presence of PN-1 at the cell surface (see online Figure I, available at http://atvb.ahajournals.org).
Regulation of {alpha}
-Thrombin Effects on RASMCs by Exogenous PN-1
To determine to what extent variations in the extracellular PN-1 concentration may regulate the response of RASMCs to thrombin, we measured the influence of recombinant PN-1 addition on thrombin-induced intracellular calcium mobilization and cell proliferation.
Thrombin acts on RASMCs via the activation of its G-protein–coupled receptor PAR-1, inducing an increase in [Ca2+], which is one of the earliest events measurable in thrombin-stimulated cells. The effect of exogenous PN-1 on {alpha}
-thrombin–induced calcium mobilization was examined in fluo3-AM–loaded cells. Addition of 2 nmol/L {alpha}
-thrombin to RASMCs induced a transient and important increase in [Ca2+]i. PN-1 dose-dependently blocked the thrombin-induced calcium signal When norepinephrine, another agonist that induces a calcium signal, was used, PN-1 had no effect on the signal, confirming the specific effect of PN-1 on thrombin (data not shown).
fig.ommitted
PN-1 inhibits thrombin-induced cell responses. A, Intracellular calcium mobilization. Cells were stimulated with 2 nmol/L {alpha}
-thrombin in the absence (x) or in the presence () of 10 nmol/L, 20 nmol/L (), and 30 nmol/L () PN-1. Results are presented as the difference between the mean fluorescence before addition of thrombin (F0) and during treatment (F) (thrombin was added after 40 seconds). The results are representative of two different experiments. B, Proliferation assay. Quiescent RASMCs were treated with 10 nmol/L {alpha}
-thrombin in the presence of increasing amounts of PN-1. Control represents nonstimulated RASMCs. Results are the mean±SD of triplicates from 1 representative experiment out of 2.
Thrombin is well-known to be a potent mitogen for RASMCs. As shown in, 10 nmol/L {alpha}
-thrombin elicited a 2.5-fold increase in cell proliferation after 48 hours of stimulation compared with control (absence of added thrombin). In the presence of PN-1, thrombin-induced cell proliferation was inhibited in a dose-dependent manner.
Presence of PN-1 in the Rat Aortic Wall
The presence of the PN-1 transcript in aortas was observed by RT-PCR analysis. PN-1 protein was also detected in aortas by Western blotting as a single band of 45 kDa. In contrast to RASMCs, no additional high-molecular-mass band was observed. Similar results were observed with the samples of aorta devoid of adventitia and endothelium, indicating the presence of PN-1 in the media.
To determine whether the PN-1 present in the aortic wall was functional, we analyzed the covalent complexes formed during incubation of aortic homogenates with radiolabeled {alpha}
-thrombin by SDS-PAGE followed by autoradiography. As shown in a major 36.5-kDa band was present, which corresponds with free, noncovalently bound thrombin. The 81-kDa band was identified as an equimolecular complex between 125I-{alpha}
-thrombin and PN-1 present in the aortic extracts for the following reasons: (1) the migration rates of this band and the complex formed between labeled {alpha}
-thrombin and recombinant rat PN-1 were similar; and (2) the presence of PN-1 in the 81-kDa complex was confirmed by Western blotting with the monoclonal antibody anti-PN-1 . This result indicates that PN-1 associated with aortic extracts was functional and confirmed that the complexes were covalent, because they were resistant to dissociation in boiling SDS. An additional major 95-kDa band was observed in the autoradiography with the aortic homogenates. Because of its electrophoretic mobility and because purified antithrombin complexed with 125I-{alpha}
-thrombin had the same electrophoretic profile, this 95-kDa complex represents the binding of 125I-{alpha}
-thrombin to antithrombin originating from blood contamination present in the aortic extracts. Specificity of the thrombin linkage in the complexes formed with the aortic extracts was also investigated by adding simultaneously 125I-{alpha}
-thrombin and a 100-fold molar excess of unlabelled {alpha}
-thrombin; the formation of the complex was prevented, whereas the intensity of the band corresponding to unbound labeled {alpha}
-thrombin was increased . The effect of different thrombin inhibitors on complex formation was also studied. PPACK is a direct active site inhibitor, whereas hirudin, a thrombin-specific inhibitor from the leech, binds both to the thrombin macromolecular recognition site called exosite 1 and to the thrombin catalytic site.17 Both PPACK and hirudin blocked the formation of the complex between 125I-{alpha}
-thrombin and PN-1 in the aortic homogenates, confirming the involvement of the thrombin catalytic site in the covalent linkage In contrast, the C-terminal tail of hirudin (SH54-65), which binds exclusively to thrombin exosite 1, did not affect complex formation Heparin is known to increase thrombin inhibition by serpins. In the presence of heparin, the amount of thrombin bound to both PN-1 and AT was increased, paralleling a decrease in the band corresponding to free 125I-{alpha}
-thrombin
fig.ommitted
Thrombin forms a specific 81-kDa covalent complex with PN-1 expressed in rat aorta. A, Autoradiography and Western blot of covalent complexes formed between 125I-{alpha}
-thrombin and recombinant PN-1 or aortic extracts. 125I-{alpha}
-thrombin was incubated with recombinant rat PN-1 (+rec PN-1) or with aortic homogenates from control rats (control). 125I-{alpha}
-thrombin/AT corresponds to the thrombin-antithrombin complex. B, Autoradiography of covalent complexes formed between 125I-{alpha}
-thrombin and aortic extracts. Samples were also prepared in the presence of heparin (+heparin), with a 100-fold excess of cold thrombin (+cold {alpha}
-th), in the presence of PPACK (+PPACK), with hirudin (+hirudin), or in the presence of the C-terminal part of hirudin (+SH54 to 65). The last sample corresponds to 125I-{alpha}
-thrombin incubated with purified AT (+AT).
The localization of PN-1 in the aortic wall was determined by immunohistochemical staining on fixed cryosections of aortic tissue. The labeling revealed that PN-1 was present in the medial smooth muscle cells
fig.ommitted
Localization of PN-1 in the aortic media. Positive staining for PN-1 was observed in the rat aortic media using 4B3. Negative staining was obtained with a irrelevant antibody. Bar=50 µm.
Regulation of Arterial PN-1 Expression by Chronic L-NAME Administration
Long-term inhibition of NOS is known to induce hypertension and perivascular fibrosis.18 Recent evidence also suggests that chronic blockade of NO production induces expression of a member of the serpin superfamily, PAI-1, in vascular tissues, both the upregulation of this PAI-1 expression and the structural changes being prevented by ACE inhibition.19 We hypothesized that PN-1, which belongs to the same superfamily of serine protease inhibitors, could also be regulated at the gene level by long-term NOS inhibition.
No significant differences in body weight (Table I, available online at http://atvb.ahajournals.org) were observed between the 3 groups of rats. As previously described, the systolic blood pressure increased compared with the control rats during the first 3 weeks of administration of L-NAME and remained constant during the following 5 weeks.20 In L-NAME plus ACE inhibitor–treated rats, systolic blood pressure was not different from control levels.
As previously reported by others,19,21 a significant increase in PAI-1 mRNA levels in the aorta was observed after 8 weeks of L-NAME treatment, and the increase was prevented by simultaneous administration of the ACE inhibitor zofenopril (not shown). We also observed a marked increase in PN-1 mRNA (3.5-fold) and protein (2-fold) levels (see Figure II, available online at http://atvb.ahajournals.org.), which were prevented by zofenopril administration. Because the structural changes induced by chronic NOS inhibition mainly involve a biological response of the media, similar analyses were performed in the aorta devoid of its adventitia and endothelium. A 2-fold upregulation of PN-1 mRNA and protein levels was observed in the media extracts from L-NAME rats compared with control rats (see Figure II, available online at http://www.ahajournals.org).
Effect of Angiotensin II and NO Donors on PN-1 Expression in RASMCs
Because suppression of NOS activity is linked to the enhancement of blood pressure via the potentiation of angiotensin II (Ang II) signalization,22 we tested the ability of Ang II to modify PN-1 expression in RASMCs. RASMCs were incubated with 100 nmol/L Ang II. The relative PN-1 mRNA levels, expressed as a percentage of the control (mean±SD of triplicates from 1 representative experiment out of 3), were 101 ±22%, 100±19%, 104±3%, and 84±2% after 3, 6, 18, and 24 hours of incubation with Ang II, respectively, indicating that Ang II did not significantly modify PN-1 mRNA expression. The effect of an NO donor (100 µmol/L nitroprusside) was tested in parallel. The relative PN-1 mRNA levels expressed as a percentage of the control (mean±SD of triplicates from 1 representative experiment out of 2) were 103±12%, 115±10%, 98±19%, and 112±10% after 30 minutes and 3, 6, and 12 hours of incubation with the NO donor, respectively, indicating that nitroprusside did not modulate PN-1 mRNA expression in RASMCs.
Discussion
Much has been reported about PN-1 expression in foreskin fibroblasts,23 but these are the first studies showing PN-1 expression in cultured RASMCs and in the rat aortic wall. We found that both the messenger and the protein corresponding to this serpin were significantly expressed in cultured RASMCs. An additional immunoreactive band migrating at {approx}
110 kDa was also detected; its nature is yet unknown, and the possibility that it might correspond to PN-1 complexed with a protease present in cultured RASMCs should be tested. A similar band has also been detected in mouse skeletal muscle extracts.24 PN-1 expression by RASMCs was not limited to in vitro conditions, because PN-1 transcripts and the protein were also detected in aortic homogenates. Moreover, the PN-1 expressed by the vasculature fulfilled all the criteria of a functionally active serpin: it formed specific covalent complexes with thrombin involving the catalytic site of the protease, and heparin increased the formation of these complexes. We observed the presence of PN-1 at the RASMC surface, supporting the existence of constitutive PN-1 secretion by SMCs. Whether the amount of PN-1 produced locally is sufficient to modulate the response of SMCs to thrombin remains to be demonstrated. Nevertheless, the experiments presented here indicate that the cellular effects of thrombin can be inhibited dose-dependently by PN-1. Moreover, PN-1 has been reported to be a potent inhibitor of factor XIa in the presence of heparin, and factor XIa plays a role in the formation of thrombin via the contact activation blood-clotting pathway.25 This raises the interesting question of the possible involvement of PN1 in pathological conditions.
Vessels respond to chronic hypertension by adaptive mechanisms, including SMC hypertrophy. Under these conditions, the expression of several genes, including antiproteases, are modified. We have thus studied PN-1 expression in a well-characterized model of hypertension induced by the chronic administration of L-NAME to rats19 and demonstrate for the first time that long-term NOS inhibition upregulates the expression of functionally active PN-1 in the aortic wall. PN-1 mRNA levels were increased in vessels devoid of adventitia and endothelium, suggesting that PN-1 upregulation mainly depends on SMCs. Whether PN-1 may contribute to the vascular pathology that develops during long-term NOS inhibition could be investigated by studying mice that are deficient in PN-1.26
PN-1 expression was normalized in L-NAME rats treated with the ACE inhibitor. It has already been shown that ACE inhibition reverses hypertension induced by L-NAME and all of the accompanying modifications of the gene expression pattern in the arterial wall.20,27 This suggests that either Ang II or NO could be involved in PN-1 overexpression, as has been demonstrated for PAI-1.28,29 However, neither Ang II nor NO donors had a direct effect on PN-1 expression in RASMCs, indicating that the molecular mechanisms responsible for the induction of PN-1 and PAI-1 expression differ. Several injury-induced related factors have been shown to stimulate PN-1 expression in cultured brain cells30 and in fibroblasts.31 Moreover, proinflammatory factors are known to be significantly increased in the vascular wall of rats after L-NAME administration,27 so they may be involved in PN-1 overexpression. The effect of proinflammatory factors on PN-1 expression in RASMC cultures is presently under investigation.
In conclusion, we show in the present study that a potent thrombin inhibitor, PN-1, is expressed by RASMCs in culture and is present in the media of rat aorta and that its expression is upregulated in an animal model of chronic hypertension. These observations suggest that PN-1 could be involved in the processes of protection of the vasculature against the effects of thrombin. The potential role of PN-1 as a molecular effector of the vascular response to hypertension clearly warrants additional investigation. The question is of importance, because thrombin receptors have been shown to be functionally increased in the vascular smooth muscle layer of hypertensive rat aortas,32 suggesting a role for thrombin in modulating aortic tone and stiffness in hypertensive rats.
Acknowledgments
This study was supported by INSERM, Université Paris VII, and grant No. 287/5z090D from Sanofi. The technical assistance of Laurence Venisse for protein purification is gratefully acknowledged. We thank Liliane Louedec for her help with animal experimentation and Drs Christophe Boixel and Maria Pueyo for their technical advice. We acknowledge Dr Cecile Pouzet for her technical assistance with the confocal microscopy.
Received September 26, 2002; accepted October 15, 2002.
References
Reinhard E, Meier R, Halfter W, Rovelli G, Monard D. Detection of glia-derived nexin in the olfactory system of the rat. Neuron. 1988; 1: 387–394.
Baker JB, Low DA, Simmer RL, Cunningham DD. Protease-nexin: a cellular component that links thrombin and plasminogen activator and mediates their binding to cells. Cell. 1980; 21: 37–45.
Mbebi C, Hantai D, Jandrot-Perrus M, Doyennette MA, Verdiere-Sahuque M. Protease nexin I expression is up-regulated in human skeletal muscle by injury-related factors. J Cell Physiol. 1999; 179: 305–314.
Cunningham DD, Pulliam L, Vaughan PJ. Protease nexin-1 and thrombin: injury-related processes in the brain. Thromb Haemost. 1993; 70: 168–171.
Knauer MF, Kridel SJ, Hawley SB, Knauer DJ. The efficient catabolism of thrombin-protease nexin 1 complexes is a synergistic mechanism that requires both the LDL receptor-related protein and cell surface heparins. J Biol Chem. 1997; 272: 29039–29045.
Wagner SL, Lau AL, Cunningham DD. Binding of protease nexin-1 to the fibroblast surface alters its target proteinase specificity. J Biol Chem. 1989; 264: 611–615.
Donovan FM, Vaughan PJ, Cunningham DD. Regulation of protease nexin-1 target protease specificity by collagen type IV. J Biol Chem. 1994; 269: 17199–17205.
Stone SR, Nick H, Hofsteenge J, Monard D. Glial-derived neurite-promoting factor is a slow-binding inhibitor of trypsin, thrombin, and urokinase. Arch Biochem Biophys. 1987; 252: 237–244.
Patterson C, Stouffer GA, Madamanchi N, Runge MS. New tricks for old dogs: nonthrombotic effects of thrombin in vessel wall biology. Circ Res. 2001; 88: 987–997.
Smith EB, Crosbie L, Carey S. Prothrombin-related antigens in human aortic intima. Semin Thromb Hemost. 1996; 22: 347–350.
Stoop AA, Lupu F, Pannekoek H. Colocalization of thrombin, PAI-1, and vitronectin in the atherosclerotic vessel wall: a potential regulatory mechanism of thrombin activity by PAI-1/vitronectin complexes. Arterioscler Thromb Vasc Biol. 2000; 20: 1143–1149.
Bezeaud A, Denninger MH, Guillin MC. Interaction of human alpha-thrombin and gamma-thrombin with antithrombin III, protein C and thrombomodulin. Eur J Biochem. 1985; 153: 491–496.
Sommer J, Gloor SM, Rovelli GF, Hofsteenge J, Nick H, Meier R, Monard D. cDNA sequence coding for a rat glia-derived nexin and its homology to members of the serpin superfamily. Biochemistry. 1987; 26: 6407–6410.
Battle T, Arnal JF, Challah M, Michel JB. Selective isolation of rat aortic wall layers and their cell types in culture: application to converting enzyme activity measurement. Tissue Cell. 1994; 26: 943–955.
Lepailleur-Enouf D, Valdenaire O, Philippe M, Jandrot-Perrus M, Michel JB. Thrombin induces endothelin expression in arterial smooth muscle cells. Am J Physiol Heart Circ Physiol. 2000; 278: H1606–H1612.
Bleuel A, de Gasparo M, Whitebread S, Puttner I, Monard D. Regulation of protease nexin-1 expression in cultured Schwann cells is mediated by angiotensin II receptors. J Neurosci. 1995; 15: 750–761.
Markwardt F. Hirudin and derivatives as anticoagulant agents. Thromb Haemost. 1991; 66: 141–152.
Zatz R, Baylis C. Chronic nitric oxide inhibition model six years on. Hypertension. 1998; 32: 958–964.
Corseaux D, Ollivier V, Fontaine V, Huisse MG, Philippe M, Louedec L, Vranckx R, Ravanat C, Lanza F, Angles-Cano E, Guillin MC, Michel JB. Hemostasis imbalance in experimental hypertension. Mol Med. 2002; 8: 169–178.
Luvara G, Pueyo ME, Philippe M, Mandet C, Savoie F, Henrion D, Michel JB. Chronic blockade of NO synthase activity induces a proinflammatory phenotype in the arterial wall: prevention by angiotensin II antagonism. Arterioscler Thromb Vasc Biol. 1998; 18: 1408–1416.
Kaikita K, Fogo AB, Ma L, Schoenhard JA, Brown NJ, Vaughan DE. Plasminogen activator inhibitor-1 deficiency prevents hypertension and vascular fibrosis in response to long-term nitric oxide synthase inhibition. Circulation. 2001; 104: 839–844.
Henrion D, Dowell FJ, Levy BI, Michel JB. In vitro alteration of aortic vascular reactivity in hypertension induced by chronic NG-nitro-L-arginine methyl ester. Hypertension. 1996; 28: 361–366.
Eaton DL, Baker JB. Evidence that a variety of cultured cells secrete protease nexin and produce a distinct cytoplasmic serine protease-binding factor. J Cell Physiol. 1983; 117: 175–182.
Akaaboune M, Hantai D, Smirnova I, Lachkar S, Kapsimali M, Verdiere-Sahuque M, Festoff BW. Developmental regulation of the serpin, protease nexin I, localization during activity-dependent polyneuronal synapse elimination in mouse skeletal muscle. J Comp Neurol. 1998; 397: 572–579.
Knauer DJ, Majumdar D, Fong PC, Knauer MF. SERPIN regulation of factor Xia: the novel observation that protease nexin 1 in the presence of heparin is a more potent inhibitor of factor XIa than C1 inhibitor. J Biol Chem. 2000; 275: 37340–37346.
Murer V, Spetz JF, Hengst U, Altrogge LM, de Agostini A, Monard D. Male fertility defects in mice lacking the serine protease inhibitor protease nexin-1. Proc Natl Acad Sci U S A. 2001; 98: 3029–3033.
Gonzalez W, Fontaine V, Pueyo ME, Laquay N, Messika-Zeitoun D, Philippe M, Arnal JF, Jacob MP, Michel JB. Molecular plasticity of vascular wall during N(G)-nitro-L-arginine methyl ester-induced hypertension: modulation of proinflammatory signals. Hypertension. 2000; 36: 103–109.
van Leeuwen RT, Kol A, Andreotti F, Kluft C, Maseri A, Sperti G. Angiotensin II increases plasminogen activator inhibitor type 1 and tissue-type plasminogen activator messenger RNA in cultured rat aortic smooth muscle cells. Circulation. 1994; 90: 362–368.
Bouchie JL, Hansen H, Feener EP. Natriuretic factors and nitric oxide suppress plasminogen activator inhibitor-1 expression in vascular smooth muscle cells: role of cGMP in the regulation of the plasminogen system. Arterioscler Thromb Vasc Biol. 1998; 18: 1771–1779.
Vaughan PJ, Cunningham DD. Regulation of protease nexin-1 synthesis and secretion in cultured brain cells by injury-related factors. J Biol Chem. 1993; 268: 3720–3727.
Guttridge DC, Lau AL, Cunningham DD. Protease nexin-1, a thrombin inhibitor, is regulated by interleukin-1 and dexamethasone in normal human fibroblasts. J Biol Chem. 1993; 268: 18966–18974.
Capers Qt, Laursen JB, Fukui T, Rajagopalan S, Mori I, Lou P, Freeman BA, Berrington WR, Griendling KK, Harrison DG, Runge MS, Alexander RW, Taylor WR. Vascular thrombin receptor regulation in hypertensive rats. Circ Res. 1997; 80: 838–844.
(Marie-Christine Bouton Benjamin Richard Patrick Rossignol Monique Philippe Marie-Claude Guillin Jean)
|